Product Details
- SNP ID
-
rs77904452
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:12146022 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CAGTATGTACATTTATATGGCTTCT[G/T]TCCATATTCCTGATACTCATATGGC
- Phenotype
-
MIM: 194557
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ZNF20
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7258368] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ZNF20
- Gene Name
- zinc finger protein 20
There are no transcripts associated with this gene.
- Gene
- ZNF625
- Gene Name
- zinc finger protein 625
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_145233.3 |
567 |
Missense Mutation |
AAG,CAG |
K132Q |
NP_660276.2 |
- Gene
- ZNF625-ZNF20
- Gene Name
- ZNF625-ZNF20 readthrough (NMD candidate)
There are no transcripts associated with this gene.
View Full Product Details