Product Details
- SNP ID
-
rs77950405
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:17594569 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ATCCAGCCGGCTTTCCAGGGTGTTG[C/G]AAACCTTTATTTTACGATCTCCATT
- Phenotype
-
MIM: 108746
MIM: 609303
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ATP6V1E1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs76511316] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ATP6V1E1
- Gene Name
- ATPase H+ transporting V1 subunit E1
- Gene
- LOC101929372
- Gene Name
- uncharacterized LOC101929372
There are no transcripts associated with this gene.
- Gene
- SLC25A18
- Gene Name
- solute carrier family 25 member 18
There are no transcripts associated with this gene.
View Full Product Details