Product Details

SNP ID: rs113554787
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:3047491 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGCTGCAGAGCCCTGAGAAGTTGC[A/G]CGATGCCATCAAAGTCATGCAGAGG
Phenotype: MIM: 608482
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC100128770 PubMed Links

Gene Details

Gene: LOC100128770
Gene Name: uncharacterized LOC100128770

There are no transcripts associated with this gene.

Gene: MMP25
Gene Name: matrix metallopeptidase 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022468.4	413	Missense Mutation	CAC,CGC	H59R	NP_071913.1
XM_011522602.2	413	Intron			XP_011520904.1
XM_011522604.2	413	Intron			XP_011520906.1
XM_011522605.2	413	Intron			XP_011520907.1
XM_017023561.1	413	Missense Mutation	CAC,CGC	H59R	XP_016879050.1

Gene: MMP25-AS1
Gene Name: MMP25 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details