Product Details

SNP ID: rs112776865
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:81922845 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTCCACCTCCTGCTGCAGCTCCGC[C/T]TTCTGCTTCTCCAGCTCCTCCTTCT
Phenotype: MIM: 602020 MIM: 179035 MIM: 606212
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MAFG PubMed Links

Gene Details

Gene: MAFG
Gene Name: MAF bZIP transcription factor G

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002359.3	462	Silent Mutation	AAA,AAG	K83K	NP_002350.1
NM_032711.3	462	Silent Mutation	AAA,AAG	K83K	NP_116100.2
XM_011523578.1	462	Silent Mutation	AAA,AAG	K83K	XP_011521880.1

Gene: MAFG-AS1
Gene Name: MAFG antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: PYCR1
Gene Name: pyrroline-5-carboxylate reductase 1

There are no transcripts associated with this gene.

Gene: SIRT7
Gene Name: sirtuin 7

There are no transcripts associated with this gene.

View Full Product Details