Product Details

SNP ID: rs112218441
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:63828210 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTGTCCAAGATTGAAGAACTCCAG[C/G]TGAGGACGGACTCCAGAGGGAGCTA
Phenotype: MIM: 613369 MIM: 601681 MIM: 601736
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DDX42 PubMed Links

Gene Details

Gene: DDX42
Gene Name: DEAD-box helicase 42

There are no transcripts associated with this gene.

Gene: FTSJ3
Gene Name: FtsJ homolog 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017647.3		Intron			NP_060117.3

Gene: PSMC5
Gene Name: proteasome 26S subunit, ATPase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199163.1		Intron			NP_001186092.1
NM_002805.5		Intron			NP_002796.4

Gene: SMARCD2
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2

There are no transcripts associated with this gene.

View Full Product Details