Product Details

SNP ID: rs115944738
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:17404815 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCCCCGCCCAAGTGACATGCCCAG[C/T]GAGAGTTTCAAGATCCCCCATATCA
Phenotype: MIM: 600534
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: BISPR PubMed Links

Gene Details

Gene: BISPR
Gene Name: BST2 interferon stimulated positive regulator (non-protein coding)

There are no transcripts associated with this gene.

Gene: BST2
Gene Name: bone marrow stromal cell antigen 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004335.3		Intron			NP_004326.1

Gene: LOC105372343
Gene Name: uncharacterized LOC105372343

There are no transcripts associated with this gene.

Gene: MVB12A
Gene Name: multivesicular body subunit 12A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304547.1		Intron			NP_001291476.1
NM_138401.3		Intron			NP_612410.1

View Full Product Details