Product Details

SNP ID: rs112683953
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:17788868 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCCAAGGTCAGCACAGCCACTCAG[C/G]CTGCTCCACTGCGGGACGCCTTGGA
Phenotype: MIM: 608882
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LINC00528 PubMed Links

Gene Details

There are no transcripts associated with this gene.

Gene: MICAL3
Gene Name: microtubule associated monooxygenase, calponin and LIM domain containing 3

Transcript Accession	SNP Location	SNP Type	Protein ID
NM_001122731.2	8592	Intron	NP_001116203.1
NM_001136004.3	8592	Intron	NP_001129476.1
NM_015241.2	8592	UTR 3	NP_056056.2
XM_005261262.3	8592	UTR 3	XP_005261319.1
XM_011546137.2	8592	UTR 3	XP_011544439.1
XM_011546139.2	8592	UTR 3	XP_011544441.1
XM_011546142.2	8592	UTR 3	XP_011544444.1
XM_011546146.2	8592	Intron	XP_011544448.1
XM_017028865.1	8592	UTR 3	XP_016884354.1
XM_017028866.1	8592	UTR 3	XP_016884355.1
XM_017028867.1	8592	UTR 3	XP_016884356.1
XM_017028868.1	8592	UTR 3	XP_016884357.1
XM_017028869.1	8592	UTR 3	XP_016884358.1
XM_017028870.1	8592	UTR 3	XP_016884359.1
XM_017028871.1	8592	UTR 3	XP_016884360.1
XM_017028872.1	8592	UTR 3	XP_016884361.1
XM_017028873.1	8592	UTR 3	XP_016884362.1
XM_017028874.1	8592	UTR 3	XP_016884363.1
XM_017028875.1	8592	UTR 3	XP_016884364.1
XM_017028876.1	8592	UTR 3	XP_016884365.1
XM_017028877.1	8592	UTR 3	XP_016884366.1
XM_017028878.1	8592	UTR 3	XP_016884367.1
XM_017028879.1	8592	UTR 3	XP_016884368.1
XM_017028880.1	8592	UTR 3	XP_016884369.1
XM_017028881.1	8592	UTR 3	XP_016884370.1
XM_017028882.1	8592	UTR 3	XP_016884371.1
XM_017028883.1	8592	UTR 3	XP_016884372.1
XM_017028884.1	8592	UTR 3	XP_016884373.1
XM_017028885.1	8592	UTR 3	XP_016884374.1
XM_017028886.1	8592	UTR 3	XP_016884375.1
XM_017028887.1	8592	Intron	XP_016884376.1