Product Details

SNP ID: rs114490343
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137426325 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCGAGGAGTGGCCAACTTCCAGCT[A/G]GCAAGGTGAGTACAGGGGTGCCTTG
Phenotype: MIM: 616748 MIM: 611255
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ENTPD8 PubMed Links

Gene Details

Gene: ENTPD8
Gene Name: ectonucleoside triphosphate diphosphohydrolase 8

There are no transcripts associated with this gene.

Gene: EXD3
Gene Name: exonuclease 3'-5' domain containing 3

There are no transcripts associated with this gene.

Gene: NOXA1
Gene Name: NADPH oxidase activator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256067.1	296	Silent Mutation	CTA,CTG	L85L	NP_001242996.1
NM_001256068.1	296	Silent Mutation	CTA,CTG	L85L	NP_001242997.1
NM_006647.1	296	Silent Mutation	CTA,CTG	L85L	NP_006638.1
XM_011518158.2	296	Silent Mutation	CTA,CTG	L85L	XP_011516460.1
XM_011518159.1	296	UTR 5			XP_011516461.1
XM_011518160.1	296	UTR 5			XP_011516462.1
XM_017014220.1	296	Intron			XP_016869709.1

View Full Product Details