Product Details
- SNP ID
-
rs117579788
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:31451550 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ATCTTCTGGATTCAAATTTCAAACT[A/G]TTGCAGTTACTGGCTTTCCATTCTC
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
DTD2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs71430960] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DTD2
- Gene Name
- D-tyrosyl-tRNA deacylase 2 (putative)
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_080664.2 |
|
Intron |
|
|
NP_542395.1 |
- Gene
- LOC101927124
- Gene Name
- uncharacterized LOC101927124
There are no transcripts associated with this gene.
View Full Product Details