Product Details

SNP ID: rs114012107
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:133978460 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTTTCGTTTCCCCATGAAATTCAG[C/T]GAGACAGACATTATGCTTCTAGAAA
Phenotype: MIM: 604492
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C5orf15 PubMed Links

Gene Details

Gene: C5orf15
Gene Name: chromosome 5 open reading frame 15

There are no transcripts associated with this gene.

Gene: LOC105379183
Gene Name: uncharacterized LOC105379183

There are no transcripts associated with this gene.

Gene: VDAC1
Gene Name: voltage dependent anion channel 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003374.2		Intron			NP_003365.1
XM_005272075.3		Intron			XP_005272132.1
XM_017009821.1		Intron			XP_016865310.1
XM_017009822.1		Intron			XP_016865311.1
XM_017009823.1		Intron			XP_016865312.1

View Full Product Details