Product Details

SNP ID: rs117151080
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:15097371 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGCGCACTGGGCGCCGGTGCTGTT[A/G]CCTTCAGGTGACCACGGATTCGCCA
Phenotype: MIM: 603801 MIM: 606116
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ACBD7 PubMed Links

Gene Details

Gene: ACBD7
Gene Name: acyl-CoA binding domain containing 7

There are no transcripts associated with this gene.

Gene: C10orf111
Gene Name: chromosome 10 open reading frame 111

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153244.1	192	Intron			NP_694976.1

Gene: NMT2
Gene Name: N-myristoyltransferase 2

There are no transcripts associated with this gene.

Gene: RPP38
Gene Name: ribonuclease P/MRP subunit p38

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001097590.2	192	UTR 5			NP_001091059.1
NM_001265601.1	192	UTR 5			NP_001252530.1
NM_006414.4	192	UTR 5			NP_006405.2
NM_183005.4	192	UTR 5			NP_892117.1
XM_006717363.1	192	Intron			XP_006717426.1
XM_006717364.3	192	UTR 5			XP_006717427.1
XM_011519293.1	192	Intron			XP_011517595.1
XM_017015479.1	192	Intron			XP_016870968.1
XM_017015480.1	192	UTR 5			XP_016870969.1
XM_017015481.1	192	Intron			XP_016870970.1

View Full Product Details