Product Details
- SNP ID
-
rs138980199
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.10:45000680 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTCTCAAAAATCTCAAAATTTGTGG[A/C]AAGTATGCAGTTTCTAGGTTGGAGA
- Phenotype
-
MIM: 610559
MIM: 194529
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
C10orf25
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs12269028,rs41301609] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C10orf25
- Gene Name
- chromosome 10 open reading frame 25
- Gene
- RASSF4
- Gene Name
- Ras association domain family member 4
There are no transcripts associated with this gene.
- Gene
- ZNF22
- Gene Name
- zinc finger protein 22
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_006963.4 |
231 |
Intron |
|
|
NP_008894.2 |
View Full Product Details