Product Details

SNP ID: rs139725672
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:119342638 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCCGCTGCAGTTGTCATCGCTGC[C/T]ATCGGTGCAGTCTCTCCACATGTCA
Phenotype: MIM: 608752 MIM: 606227 MIM: 606130
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C1QTNF5 PubMed Links

Gene Details

Gene: C1QTNF5
Gene Name: C1q and tumor necrosis factor related protein 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278431.1	1505	Intron			NP_001265360.1
NM_015645.4	1505	UTR 5			NP_056460.1

Gene: MFRP
Gene Name: membrane frizzled-related protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_031433.3	1505	Missense Mutation	AGC,GGC	S449G	NP_113621.1

Gene: RNF26
Gene Name: ring finger protein 26

There are no transcripts associated with this gene.

View Full Product Details