Product Details

SNP ID: rs141647254
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:10799686 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAACAGTTCCTTCTCCAATTTGAG[A/G]AGTGGGAATAAGAAACTCAGTCCCT
Phenotype: MIM: 602325
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EIF4G2 PubMed Links

Gene Details

Gene: EIF4G2
Gene Name: eukaryotic translation initiation factor 4 gamma 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042559.2	2493	Silent Mutation	CTC,CTT	L692L	NP_001036024.3
NM_001172705.1	2493	Silent Mutation	CTC,CTT	L730L	NP_001166176.1
NM_001418.3	2493	Silent Mutation	CTC,CTT	L730L	NP_001409.3

Gene: LOC101928053
Gene Name: uncharacterized LOC101928053

There are no transcripts associated with this gene.

Gene: SNORD97
Gene Name: small nucleolar RNA, C/D box 97

There are no transcripts associated with this gene.

View Full Product Details