Product Details

SNP ID: rs151118817
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:56229110 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTCCCTCCCACCCACCCAGCACCC[A/G]AATCACTCGAAGCCAGCCCAACCAC
Phenotype: MIM: 612104 MIM: 608730
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ANKRD52 PubMed Links

Gene Details

Gene: ANKRD52
Gene Name: ankyrin repeat domain 52

There are no transcripts associated with this gene.

Gene: NABP2
Gene Name: nucleic acid binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024068.3	677	Missense Mutation	CAA,CGA	Q178R	NP_076973.1
XM_005269146.2	677	Missense Mutation	CAA,CGA	Q221R	XP_005269203.1
XM_005269147.2	677	Missense Mutation	CAA,CGA	Q194R	XP_005269204.1
XM_005269148.4	677	Missense Mutation	CAA,CGA	Q178R	XP_005269205.1
XM_005269149.4	677	Missense Mutation	CAA,CGA	Q178R	XP_005269206.1

Gene: RNF41
Gene Name: ring finger protein 41

There are no transcripts associated with this gene.

Gene: SLC39A5
Gene Name: solute carrier family 39 member 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135195.1	677	Intron			NP_001128667.1
NM_173596.2	677	Intron			NP_775867.2
XM_005268803.1	677	Intron			XP_005268860.1
XM_011538198.1	677	Intron			XP_011536500.1
XM_011538199.1	677	Intron			XP_011536501.1
XM_011538200.1	677	Intron			XP_011536502.1
XM_011538201.1	677	Intron			XP_011536503.1
XM_017019185.1	677	Intron			XP_016874674.1
XM_017019186.1	677	Intron			XP_016874675.1
XM_017019187.1	677	Intron			XP_016874676.1

View Full Product Details