Product Details

SNP ID: rs139437413
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:31076398 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTCCCAGCCTCCCAGAGCTCTCTC[A/G]GCACCGAGAACTGCTCCATCCATCT
Phenotype: MIM: 610561
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PRSS53 PubMed Links

Gene Details

Gene: PRSS53
Gene Name: protease, serine 53

There are no transcripts associated with this gene.

Gene: ZNF646
Gene Name: zinc finger protein 646

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014699.3	1142	Missense Mutation	CAG,CGG	Q25R	NP_055514.3
XM_005255710.3	1142	Missense Mutation	CAG,CGG	Q25R	XP_005255767.1
XM_005255711.3	1142	Missense Mutation	CAG,CGG	Q25R	XP_005255768.1
XM_005255712.3	1142	Missense Mutation	CAG,CGG	Q25R	XP_005255769.1
XM_011545990.2	1142	Missense Mutation	CAG,CGG	Q25R	XP_011544292.1

Gene: ZNF668
Gene Name: zinc finger protein 668

There are no transcripts associated with this gene.

View Full Product Details