Product Details

SNP ID: rs140443878
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4426044 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCCTTTGCGTCTTCCCTGACCTCT[C/T]GCGGCCCCCGAGCGCTGCTGACATT
Phenotype: MIM: 611668 MIM: 608382
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CORO7 PubMed Links

Gene Details

Gene: CORO7
Gene Name: coronin 7

There are no transcripts associated with this gene.

Gene: CORO7-PAM16
Gene Name: CORO7-PAM16 readthrough

There are no transcripts associated with this gene.

Gene: DNAJA3
Gene Name: DnaJ heat shock protein family (Hsp40) member A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135110.2	240	Missense Mutation	CGC,TGC	R55C	NP_001128582.1
NM_001286516.1	240	Missense Mutation	TCG,TTG	S18L	NP_001273445.1
NM_005147.5	240	Missense Mutation	CGC,TGC	R55C	NP_005138.3

View Full Product Details