Product Details

SNP ID: rs144008264
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:1772513 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCCGCGCCTCGCTCTCAGTCTTC[C/T]CTGATGAAGAAAAAGAGGCGTCTGC
Phenotype: MIM: 610886 MIM: 605431 MIM: 611994 MIM: 601817 MIM: 611659
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EME2 PubMed Links

Gene Details

Gene: EME2
Gene Name: essential meiotic structure-specific endonuclease subunit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001257370.1	406	Intron			NP_001244299.1
XM_017023025.1	406	Intron			XP_016878514.1
XM_017023026.1	406	Intron			XP_016878515.1

Gene: MAPK8IP3
Gene Name: mitogen-activated protein kinase 8 interacting protein 3

There are no transcripts associated with this gene.

Gene: MRPS34
Gene Name: mitochondrial ribosomal protein S34

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300900.1	406	Missense Mutation	GAG,GGG	E129G	NP_001287829.1
NM_023936.1	406	Missense Mutation	GAG,GGG	E122G	NP_076425.1
XM_017023595.1	406	Missense Mutation	GAG,GGG	E152G	XP_016879084.1

Gene: NME3
Gene Name: NME/NM23 nucleoside diphosphate kinase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002513.2	406	Intron			NP_002504.2
XM_005255332.4	406	Intron			XP_005255389.1
XM_011522503.2	406	Intron			XP_011520805.1
XM_011522504.2	406	Intron			XP_011520806.1

Gene: SPSB3
Gene Name: splA/ryanodine receptor domain and SOCS box containing 3

There are no transcripts associated with this gene.

View Full Product Details