Product Details

SNP ID: rs138675628
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:2324211 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTGAATCCATTACTCCATGCCCCC[C/T]TGAGGCACTGTTGAAGAAATCTCAC
Phenotype: MIM: 606477 MIM: 611214
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: SNORD91A PubMed Links

Gene Details

Gene: SNORD91A
Gene Name: small nucleolar RNA, C/D box 91A

There are no transcripts associated with this gene.

Gene: SNORD91B
Gene Name: small nucleolar RNA, C/D box 91B

There are no transcripts associated with this gene.

Gene: SRR
Gene Name: serine racemase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001304803.1	2650	UTR 3			NP_001291732.1
NM_021947.2	2650	UTR 3			NP_068766.1
XM_006721565.3	2650	UTR 3			XP_006721628.1
XM_006721566.3	2650	UTR 3			XP_006721629.1
XM_011523974.2	2650	UTR 3			XP_011522276.1

Gene: TSR1
Gene Name: TSR1, ribosome maturation factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018128.4	2650	Silent Mutation	CAA,CAG	Q800Q	NP_060598.3

View Full Product Details