Product Details

SNP ID: rs148320863
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:59155788 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCACAGCCCGGACTCCATCGACT[A/C]CCCCGGCTCTTAGACTAGTAAGTGC
Phenotype: MIM: 615675 MIM: 615920 MIM: 616674
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: MIR301A PubMed Links

Gene Details

Gene: MIR301A
Gene Name: microRNA 301a

There are no transcripts associated with this gene.

Gene: PRR11
Gene Name: proline rich 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018304.3	290	UTR 5			NP_060774.2

Gene: SKA2
Gene Name: spindle and kinetochore associated complex subunit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001100595.1	290	Intron			NP_001094065.1
NM_182620.3	290	Intron			NP_872426.1
XM_011524745.2	290	Intron			XP_011523047.1

View Full Product Details