Product Details

SNP ID: rs150521076
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:47837925 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGAGGGGTGGGGCCCACTCGCC[A/G]GCCAGCAGCCCCTGTGTGGCCTCGA
Phenotype: MIM: 611825 MIM: 614966 MIM: 608613
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LRRC46 PubMed Links

Gene Details

Gene: LRRC46
Gene Name: leucine rich repeat containing 46

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033413.3	1185	Intron			NP_219481.1
XM_005257775.4	1185	Intron			XP_005257832.1

Gene: MRPL10
Gene Name: mitochondrial ribosomal protein L10

There are no transcripts associated with this gene.

Gene: SCRN2
Gene Name: secernin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145023.1	1185	UTR 3			NP_001138495.1
NM_138355.3	1185	Silent Mutation	GCC,GCT	A399A	NP_612364.2
XM_005257776.4	1185	Silent Mutation	GCC,GCT	A399A	XP_005257833.1
XM_017025286.1	1185	Silent Mutation	GCC,GCT	A377A	XP_016880775.1

Gene: SP6
Gene Name: Sp6 transcription factor

There are no transcripts associated with this gene.

View Full Product Details