Product Details

SNP ID: rs150953255
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28729226 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGGAAAGTTATACAATAAACAAA[A/G]CATTATGAAGTAAGAAGTTATAGCA
Phenotype: MIM: 609799 MIM: 602326
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NEK8 PubMed Links

Gene Details

Gene: NEK8
Gene Name: NIMA related kinase 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_178170.2		Intron			NP_835464.1
XM_011524638.2		Intron			XP_011522940.1
XM_011524640.2		Intron			XP_011522942.1
XM_017024499.1		Intron			XP_016879988.1
XM_017024500.1		Intron			XP_016879989.1
XM_017024501.1		Intron			XP_016879990.1

Gene: RPL23A
Gene Name: ribosomal protein L23a

There are no transcripts associated with this gene.

Gene: SNORD42A
Gene Name: small nucleolar RNA, C/D box 42A

There are no transcripts associated with this gene.

Gene: SNORD42B
Gene Name: small nucleolar RNA, C/D box 42B

There are no transcripts associated with this gene.

Gene: SNORD4A
Gene Name: small nucleolar RNA, C/D box 4A

There are no transcripts associated with this gene.

Gene: SNORD4B
Gene Name: small nucleolar RNA, C/D box 4B

There are no transcripts associated with this gene.

Gene: TLCD1
Gene Name: TLC domain containing 1

There are no transcripts associated with this gene.

View Full Product Details