Product Details
- SNP ID
-
rs138013990
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:8851353 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ATGAGGATGACAGCCCAGAAGGGAA[G/T]GTCTGGGGAGACAAGGGCTGGGGTG
- Phenotype
-
MIM: 607963
MIM: 606154
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MBD3L1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1035442] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MBD3L1
- Gene Name
- methyl-CpG binding domain protein 3 like 1
There are no transcripts associated with this gene.
- Gene
- MUC16
- Gene Name
- mucin 16, cell surface associated
View Full Product Details