Product Details

SNP ID
rs138441532
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.19:54574576 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GTACAGTGACCCCCTGGAGCTGGTG[A/G]TGACAGGTGAGAGGACACTCAGGAG
Phenotype
MIM: 604812
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
LILRA2 PubMed Links
Additional Information
For this assay, SNP(s) [rs533071991] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
LILRA2
Gene Name
leukocyte immunoglobulin like receptor A2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001130917.2 930 Missense Mutation ATG,GTG M116V NP_001124389.2
NM_001290270.1 930 Missense Mutation ATG,GTG M104V NP_001277199.1
NM_001290271.1 930 Missense Mutation ATG,GTG M116V NP_001277200.1
NM_006866.3 930 Missense Mutation ATG,GTG M116V NP_006857.2
XM_006722986.1 930 Missense Mutation ATG,GTG M116V XP_006723049.1
XM_011526385.1 930 Missense Mutation ATG,GTG M116V XP_011524687.1
XM_011526386.1 930 Missense Mutation ATG,GTG M104V XP_011524688.1
XM_011526387.1 930 Missense Mutation ATG,GTG M104V XP_011524689.1
XM_011526388.1 930 Missense Mutation ATG,GTG M104V XP_011524690.1
XM_011526389.1 930 Intron XP_011524691.1
XM_011526390.1 930 Missense Mutation ATG,GTG M116V XP_011524692.1
XM_011526391.1 930 Missense Mutation ATG,GTG M116V XP_011524693.1
XM_017026224.1 930 Missense Mutation ATG,GTG M116V XP_016881713.1

View Full Product Details