Product Details

SNP ID: rs140519538
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:19202498 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGGCAGCCCCGGCGACTGGAGAA[A/G]CCACCCTGAAACTGGATCTGCAGCT
Phenotype: MIM: 616601 MIM: 600826 MIM: 608719 MIM: 603200
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BORCS8 PubMed Links

Gene Details

Gene: BORCS8
Gene Name: BLOC-1 related complex subunit 8

There are no transcripts associated with this gene.

Gene: BORCS8-MEF2B
Gene Name: BORCS8-MEF2B readthrough

There are no transcripts associated with this gene.

Gene: NCAN
Gene Name: neurocan

There are no transcripts associated with this gene.

Gene: NR2C2AP
Gene Name: nuclear receptor 2C2 associated protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300945.1	600	Silent Mutation	GGC,GGT	G69G	NP_001287874.1
NM_176880.5	600	Silent Mutation	GGC,GGT	G69G	NP_795361.1
XM_011527688.2	600	Silent Mutation	GGC,GGT	G69G	XP_011525990.1

Gene: RFXANK
Gene Name: regulatory factor X associated ankyrin containing protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278727.1	600	Intron			NP_001265656.1
NM_001278728.1	600	Intron			NP_001265657.1
NM_003721.3	600	Intron			NP_003712.1
NM_134440.2	600	Intron			NP_604389.1
XM_005260134.4	600	Intron			XP_005260191.1
XM_005260135.3	600	Intron			XP_005260192.1
XM_005260136.4	600	Intron			XP_005260193.1
XM_005260137.4	600	Intron			XP_005260194.1
XM_006722930.3	600	Intron			XP_006722993.1
XM_017027415.1	600	Intron			XP_016882904.1
XM_017027416.1	600	Intron			XP_016882905.1

View Full Product Details