Product Details
- SNP ID
-
rs146760521
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:57455735 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTTGCTGTGATTGTGTTGGACTTGC[C/T]GCTTGTGTCTGTAGAGGAAGAAGAC
- Phenotype
-
MIM: 605234
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
VN1R1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs28649880] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- VN1R1
- Gene Name
- vomeronasal 1 receptor 1
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_020633.3 |
1005 |
Missense Mutation |
CAG,CGG |
Q251R |
NP_065684.1 |
- Gene
- ZNF749
- Gene Name
- zinc finger protein 749
There are no transcripts associated with this gene.
- Gene
- ZNF772
- Gene Name
- zinc finger protein 772
There are no transcripts associated with this gene.
View Full Product Details