Product Details

SNP ID: rs149534478
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:36112941 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCTTTCATGACGCCTTCGATCTCA[A/T]GCGCCACATGAGGACTCACACTGGT
Phenotype: MIM: 616442 MIM: 180662 MIM: 601303 MIM: 613583
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: OVOL3 PubMed Links

Gene Details

Gene: OVOL3
Gene Name: ovo like zinc finger 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001302757.1	341	Missense Mutation	AAG,ATG	K114M	NP_001289686.1
XM_011527251.2	341	Missense Mutation	AAG,ATG	K31M	XP_011525553.1
XM_017027190.1	341	Missense Mutation	AAG,ATG	K137M	XP_016882679.1
XM_017027191.1	341	Missense Mutation	AAG,ATG	K113M	XP_016882680.1

Gene: POLR2I
Gene Name: RNA polymerase II subunit I

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006233.4	341	Intron			NP_006224.1

Gene: TBCB
Gene Name: tubulin folding cofactor B

There are no transcripts associated with this gene.

Gene: WDR62
Gene Name: WD repeat domain 62

There are no transcripts associated with this gene.

View Full Product Details