Product Details

SNP ID: rs150431672
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:50511752 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCTCAGCAGAGATGGATCCCCGGC[C/T]TGGAGGGGAGCTGGCAGCAGGCTGC
Phenotype: MIM: 614545 MIM: 615324
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ASPDH PubMed Links

Gene Details

Gene: ASPDH
Gene Name: aspartate dehydrogenase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024656.2	892	Missense Mutation	AAG,AGG	K172R	NP_001019827.2
NM_001114598.1	892	Missense Mutation	AAG,AGG	K277R	NP_001108070.1

Gene: EMC10
Gene Name: ER membrane protein complex subunit 10

There are no transcripts associated with this gene.

Gene: JOSD2
Gene Name: Josephin domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001270639.1	892	Intron			NP_001257568.1
NM_001270640.1	892	Intron			NP_001257569.1
NM_001270641.1	892	Intron			NP_001257570.1
NM_001270686.1	892	Intron			NP_001257615.1
NM_138334.3	892	Intron			NP_612207.1
XM_011526434.2	892	Intron			XP_011524736.1

Gene: LRRC4B
Gene Name: leucine rich repeat containing 4B

There are no transcripts associated with this gene.

View Full Product Details