Product Details
- SNP ID
-
rs138006106
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
2
- Location
-
Chr.1:3781162 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GACGGGTACACCACCTTCAGGCTCC[C/T]TTCCAGATCCACCACCCGGACCTGC
- Phenotype
-
MIM: 615242
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CCDC27
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs6694319] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CCDC27
- Gene Name
- coiled-coil domain containing 27
There are no transcripts associated with this gene.
- Gene
- LRRC47
- Gene Name
- leucine rich repeat containing 47
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_020710.2 |
1706 |
Missense Mutation |
|
|
NP_065761.1 |
- Gene
- SMIM1
- Gene Name
- small integral membrane protein 1 (Vel blood group)
There are no transcripts associated with this gene.
View Full Product Details