Product Details

SNP ID: rs141525153
Assay Type: Functionally tested
NCBI dbSNP Submissions: 8
Location: Chr.1:153630605 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGGCAAAGAGGGGGACAAGTACAA[A/G]CTGAGCAAGAAGGAGCTGAAAGAGC
Phenotype: MIM: 614206 MIM: 176940 MIM: 601989
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CHTOP PubMed Links

Gene Details

Gene: CHTOP
Gene Name: chromatin target of PRMT1

There are no transcripts associated with this gene.

Gene: S100A1
Gene Name: S100 calcium binding protein A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006271.1	197	Silent Mutation	AAA,AAG	K28K	NP_006262.1

Gene: S100A13
Gene Name: S100 calcium binding protein A13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024210.1	197	Intron			NP_001019381.1
NM_001024211.1	197	Intron			NP_001019382.1
NM_001024212.1	197	Intron			NP_001019383.1
NM_001024213.1	197	Intron			NP_001019384.1
NM_005979.2	197	Intron			NP_005970.1
XM_005245434.3	197	Intron			XP_005245491.1
XM_011509862.2	197	Intron			XP_011508164.1
XM_011509863.2	197	Intron			XP_011508165.1
XM_011509864.1	197	UTR 5			XP_011508166.1
XM_017002034.1	197	Intron			XP_016857523.1
XM_017002035.1	197	Intron			XP_016857524.1
XM_017002036.1	197	Intron			XP_016857525.1

View Full Product Details