Product Details

SNP ID: rs148707904
Assay Type: Functionally tested
NCBI dbSNP Submissions: 4
Location: Chr.1:151763039 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCCAGGTTTTCTTTGGGCCGATG[C/G]TTCGTGTCCTCCACCAGCTTATAGA
Phenotype: MIM: 611824 MIM: 605138 MIM: 609501
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MRPL9 PubMed Links

Gene Details

Gene: MRPL9
Gene Name: mitochondrial ribosomal protein L9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300733.1	698	Missense Mutation	AAC,AAG	N87K	NP_001287662.1
NM_031420.3	698	Missense Mutation	AAC,AAG	N87K	NP_113608.1

Gene: OAZ3
Gene Name: ornithine decarboxylase antizyme 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134939.1	698	UTR 5			NP_001128411.1
NM_001301371.1	698	Intron			NP_001288300.1
NM_016178.2	698	Intron			NP_057262.2

Gene: TDRKH
Gene Name: tudor and KH domain containing

There are no transcripts associated with this gene.

View Full Product Details