Product Details
- SNP ID
-
rs150225142
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
14
- Location
-
Chr.1:37997805 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCCTGCCAGGGGCGTCTGGCATCC[A/G]GTACAGACCAGACATTCTCGATGCC
- Phenotype
-
MIM: 602790
MIM: 605596
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
FHL3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7366048] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- FHL3
- Gene Name
- four and a half LIM domains 3
- Gene
- SF3A3
- Gene Name
- splicing factor 3a subunit 3
There are no transcripts associated with this gene.
View Full Product Details