Product Details

SNP ID: rs148155917
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63708607 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGACGAGGAGAGCCTGGAGTCGGC[C/T]TTGCAGACCTACCGTGCGCAGCTGC
Phenotype: MIM: 604699 MIM: 603361
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARFRP1 PubMed Links

Gene Details

Gene: ARFRP1
Gene Name: ADP ribosylation factor related protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134758.3	197	Intron			NP_001128230.1
NM_001267544.2	197	Intron			NP_001254473.1
NM_001267545.2	197	Intron			NP_001254474.1
NM_001267546.2	197	Intron			NP_001254475.1
NM_001267547.2	197	Intron			NP_001254476.1
NM_001267548.2	197	Intron			NP_001254477.1
NM_001267549.2	197	Intron			NP_001254478.1
NM_003224.5	197	Intron			NP_003215.1
XM_011528482.2	197	Intron			XP_011526784.1
XM_011528483.1	197	Intron			XP_011526785.1
XM_017027576.1	197	Intron			XP_016883065.1

Gene: RTEL1-TNFRSF6B
Gene Name: RTEL1-TNFRSF6B readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TNFRSF6B
Gene Name: TNF receptor superfamily member 6b

There are no transcripts associated with this gene.

Gene: ZGPAT
Gene Name: zinc finger CCCH-type and G-patch domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001083113.1	197	Silent Mutation	GCC,GCT	A9A	NP_001076582.1
NM_001195653.1	197	Silent Mutation	GCC,GCT	A9A	NP_001182582.1
NM_001195654.1	197	Silent Mutation	GCC,GCT	A9A	NP_001182583.1
NM_032527.4	197	Silent Mutation	GCC,GCT	A9A	NP_115916.3
NM_181485.2	197	Silent Mutation	GCC,GCT	A9A	NP_852150.2

View Full Product Details