Product Details

SNP ID: rs144698481
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:50569630 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGGAAGAAGATCGTGTTCTCGCC[C/T]GCAATCATGTAGGAAACTCCATAGC
Phenotype: MIM: 612395 MIM: 601987 MIM: 615775
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHKB PubMed Links

Gene Details

Gene: CHKB
Gene Name: choline kinase beta

There are no transcripts associated with this gene.

Gene: CHKB-CPT1B
Gene Name: CHKB-CPT1B readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: CPT1B
Gene Name: carnitine palmitoyltransferase 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145134.1	2319	Silent Mutation			NP_001138606.1
NM_001145135.1	2319	Silent Mutation			NP_001138607.1
NM_001145137.1	2319	Silent Mutation			NP_001138609.1
NM_004377.3	2319	Silent Mutation			NP_004368.1
NM_152245.2	2319	Silent Mutation			NP_689451.1
NM_152246.2	2319	Silent Mutation			NP_689452.1

Gene: SYCE3
Gene Name: synaptonemal complex central element protein 3

There are no transcripts associated with this gene.

View Full Product Details