Product Details

SNP ID: rs142603103
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:196935615 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAAGCACTTACAACTAGTTACAGCT[A/C]TTTTAAAAATTCAGATTTCTACACT
Phenotype: MIM: 605133 MIM: 612845
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: NCBP2 PubMed Links

Gene Details

Gene: NCBP2
Gene Name: nuclear cap binding protein subunit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042540.1	1798	UTR 3			NP_001036005.1
NM_001308036.1	1798	UTR 3			NP_001294965.1
NM_007362.3	1798	UTR 3			NP_031388.2
XM_011512556.2	1798	UTR 3			XP_011510858.1
XM_011512557.2	1798	UTR 3			XP_011510859.1
XM_011512558.2	1798	UTR 3			XP_011510860.1

Gene: NCBP2-AS2
Gene Name: NCBP2 antisense RNA 2 (head to head)

There are no transcripts associated with this gene.

Gene: SENP5
Gene Name: SUMO1/sentrin specific peptidase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308045.1	1798	Intron			NP_001294974.1
NM_152699.4	1798	Intron			NP_689912.2
XM_005269310.2	1798	Intron			XP_005269367.1
XM_005269312.2	1798	Intron			XP_005269369.1
XM_011512544.2	1798	Intron			XP_011510846.1
XM_011512545.2	1798	Intron			XP_011510847.1
XM_017005870.1	1798	Intron			XP_016861359.1

View Full Product Details