Product Details

SNP ID: rs144506153
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49718685 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGCGGCTGTGCTGGAAGAAGCGCA[C/T]GCGGGACGCGGGTACCTTGAAGGCC
Phenotype: MIM: 615691 MIM: 615320 MIM: 606991 MIM: 614472
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AMIGO3 PubMed Links

Gene Details

Gene: AMIGO3
Gene Name: adhesion molecule with Ig like domain 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198722.2	1121	Missense Mutation			NP_942015.1

Gene: GMPPB
Gene Name: GDP-mannose pyrophosphorylase B

There are no transcripts associated with this gene.

Gene: IP6K1
Gene Name: inositol hexakisphosphate kinase 1

There are no transcripts associated with this gene.

Gene: RNF123
Gene Name: ring finger protein 123

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_022064.4	1121	Intron			NP_071347.2
XM_006713285.1	1121	Intron			XP_006713348.1
XM_011533995.1	1121	Intron			XP_011532297.1
XM_017007018.1	1121	Intron			XP_016862507.1

View Full Product Details