Product Details

SNP ID: rs145434330
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:48466770 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTCACGGAGCTGTGCCTGCTGGCT[C/G]TCCACAGATGTGCCCTGGAGAGCCC
Phenotype: MIM: 606605 MIM: 607290 MIM: 606609
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ATRIP PubMed Links

Gene Details

Gene: ATRIP
Gene Name: ATR interacting protein

There are no transcripts associated with this gene.

Gene: SHISA5
Gene Name: shisa family member 5

There are no transcripts associated with this gene.

Gene: TREX1
Gene Name: three prime repair exonuclease 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007248.3	1251	Missense Mutation	CTC,GTC	L29V	NP_009179.2
NM_016381.5	1251	Missense Mutation	CTC,GTC	L94V	NP_057465.1
NM_033629.4	1251	Missense Mutation	CTC,GTC	L39V	NP_338599.1

View Full Product Details