Product Details

SNP ID: rs148292398
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.3:43080029 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCACTTCTGCTTCCGTGGTCCTGGC[C/T]GGCCCTTCACCACGCGCCGTATGGT
Phenotype: MIM: 614828
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: POMGNT2 PubMed Links
Additional Information: For this assay, SNP(s) [rs604033] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: POMGNT2
Gene Name: protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032806.5	1756	Missense Mutation	CAG,CGG	Q468R	NP_116195.2
XM_005265515.2	1756	Missense Mutation	CAG,CGG	Q468R	XP_005265572.1
XM_011534163.2	1756	Missense Mutation	CAG,CGG	Q468R	XP_011532465.1
XM_011534164.1	1756	Missense Mutation	CAG,CGG	Q468R	XP_011532466.1
XM_017007353.1	1756	Missense Mutation	CAG,CGG	Q468R	XP_016862842.1