Product Details

SNP ID: rs146778548
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:2938857 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATTTTTTGAACTTTTTCCTCTTCA[G/T]AGCCTTCCATTCGCCTTCCTGTGTA
Phenotype: MIM: 102680 MIM: 610977 MIM: 611526
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ADD1 PubMed Links

Gene Details

Gene: ADD1
Gene Name: adducin 1

There are no transcripts associated with this gene.

Gene: MFSD10
Gene Name: major facilitator superfamily domain containing 10

There are no transcripts associated with this gene.

Gene: NOP14
Gene Name: NOP14 nucleolar protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291978.1	2735	Missense Mutation	ATG,CTG	M850L	NP_001278907.1
NM_001291979.1	2735	Intron			NP_001278908.1
NM_003703.2	2735	Missense Mutation	ATG,CTG	M850L	NP_003694.1

Gene: NOP14-AS1
Gene Name: NOP14 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details