Product Details

SNP ID: rs149532124
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:74768989 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCTATGGATACCGTTTGGATTACC[A/G]TGAGAAAAAGAGAAAGAAGGAAAGT
Phenotype: MIM: 615769 MIM: 606544 MIM: 612497
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM169A PubMed Links

Gene Details

Gene: FAM169A
Gene Name: family with sequence similarity 169 member A

There are no transcripts associated with this gene.

Gene: GFM2
Gene Name: G elongation factor mitochondrial 2

There are no transcripts associated with this gene.

Gene: NSA2
Gene Name: NSA2, ribosome biogenesis homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271665.1	432	Missense Mutation	CAT,CGT	H21R	NP_001258594.1
NM_014886.4	432	Missense Mutation	CAT,CGT	H21R	NP_055701.1
XM_011543098.1	432	Intron			XP_011541400.1
XM_017008952.1	432	Intron			XP_016864441.1
XM_017008953.1	432	Intron			XP_016864442.1

View Full Product Details