Product Details

SNP ID: rs145090083
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32181406 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACAAGATGACCCCAATGAGCAGGG[C/T]GGCTGTCCCCAGGCCTCCCAGGATC
Phenotype: MIM: 600214 MIM: 603099 MIM: 176311 MIM: 602677
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AGER PubMed Links

Gene Details

Gene: AGER
Gene Name: advanced glycosylation end product-specific receptor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001136.4	1211	Missense Mutation	ACC,GCC	T355A	NP_001127.1
NM_001206929.1	1211	Missense Mutation	ACC,GCC	T371A	NP_001193858.1
NM_001206932.1	1211	Missense Mutation	ACC,GCC	T341A	NP_001193861.1
NM_001206934.1	1211	Intron			NP_001193863.1
NM_001206936.1	1211	Intron			NP_001193865.1
NM_001206940.1	1211	Intron			NP_001193869.1
NM_001206954.1	1211	Intron			NP_001193883.1
NM_001206966.1	1211	Intron			NP_001193895.1
NM_172197.2	1211	Missense Mutation	CAC,CGC	H303R	NP_751947.1
XM_017010328.1	1211	Intron			XP_016865817.1

Gene: AGPAT1
Gene Name: 1-acylglycerol-3-phosphate O-acyltransferase 1

There are no transcripts associated with this gene.

Gene: GPSM3
Gene Name: G-protein signaling modulator 3

There are no transcripts associated with this gene.

Gene: MIR6833
Gene Name: microRNA 6833

There are no transcripts associated with this gene.

Gene: PBX2
Gene Name: PBX homeobox 2

There are no transcripts associated with this gene.

Gene: RNF5
Gene Name: ring finger protein 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006913.3	1211	Intron			NP_008844.1

View Full Product Details