Product Details

SNP ID: rs150333128
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.7:130381645 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCTCCCCAGCTGGACTTCTGGCGG[G/T]GGCCTGCCCACCCTGGCTCCCCCAT
Phenotype: MIM: 114850
Polymorphism: G/T, Transversion Substitution
Allele Nomenclature
Literature Links: CPA1 PubMed Links
Additional Information: For this assay, SNP(s) [rs1126899] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001868.3	313	Missense Mutation	GGG,TGG	G55W	NP_001859.1