Product Details
- SNP ID
-
rs114761227
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.8:20199966 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TTTTTTGTGAATTGATTGATGTTAT[C/T]ATTTAAGGGGACATGTAATTATAGT
- Phenotype
-
MIM: 606939
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ATP6V1B2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs34916825] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ATP6V1B2
- Gene Name
- ATPase H+ transporting V1 subunit B2
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001693.3 |
|
Intron |
|
|
NP_001684.2 |
View Full Product Details