Product Details

SNP ID: rs146434678
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144355534 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTGTCCCAGGTCTGTGGCTGCCTA[C/G]CTGGGTGAGGGGCTGGTGAGCAGCT
Phenotype: MIM: 609076 MIM: 607882
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FBXL6 PubMed Links

Gene Details

Gene: FBXL6
Gene Name: F-box and leucine rich repeat protein 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012162.3	76	Missense Mutation	AGC,AGG	S539R	NP_036294.2
NM_024555.5	76	Missense Mutation	AGC,AGG	S533R	NP_078831.4

Gene: SLC52A2
Gene Name: solute carrier family 52 member 2

There are no transcripts associated with this gene.

Gene: TMEM249
Gene Name: transmembrane protein 249

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252402.2	76	Intron			NP_001239331.1
NM_001252404.2	76	Intron			NP_001239333.1
NM_001280561.1	76	UTR 5			NP_001267490.1

View Full Product Details