Product Details

SNP ID: rs142372610
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:127452644 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTAGGGGCTTGACATACATGAAGTC[A/G]CTGGATCCTCATAGAAGCCAGTGTT
Phenotype: MIM: 610933 MIM: 180475 MIM: 194552
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LRSAM1 PubMed Links

Gene Details

Gene: LRSAM1
Gene Name: leucine rich repeat and sterile alpha motif containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005373.3		Intron			NP_001005373.1
NM_001005374.3		Intron			NP_001005374.1
NM_001190723.2		Intron			NP_001177652.1
NM_138361.5		Intron			NP_612370.3
XM_006717316.3		Intron			XP_006717379.1
XM_017015283.1		Intron			XP_016870772.1
XM_017015284.1		Intron			XP_016870773.1

Gene: RPL12
Gene Name: ribosomal protein L12

There are no transcripts associated with this gene.

Gene: SNORA65
Gene Name: small nucleolar RNA, H/ACA box 65

There are no transcripts associated with this gene.

Gene: ZNF79
Gene Name: zinc finger protein 79

There are no transcripts associated with this gene.

View Full Product Details