Product Details

SNP ID: rs147868113
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:127925161 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGGCCCCTCTCATCCTCGTGGAGA[C/T]GTTGGAAGGCTATCAGGAGGCTGTA
Phenotype: MIM: 603564 MIM: 612865 MIM: 606378
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DPM2 PubMed Links

Gene Details

Gene: DPM2
Gene Name: dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit

There are no transcripts associated with this gene.

Gene: PIP5KL1
Gene Name: phosphatidylinositol-4-phosphate 5-kinase like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135219.1	1956	Missense Mutation	CAT,CGT	H288R	NP_001128691.1
NM_173492.1	1956	Missense Mutation	CAT,CGT	H85R	NP_775763.1
XM_017014279.1	1956	Silent Mutation	ACA,ACG	T333T	XP_016869768.1

Gene: ST6GALNAC4
Gene Name: ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4

There are no transcripts associated with this gene.

View Full Product Details