Product Details

SNP ID: rs11546503
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:89561354 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTGCGCGCCGGCCGCGGCTTCAGC[A/C]TGGAGGAGCTCAGGGTGAGTACTGG
Phenotype: MIM: 113703 MIM: 602783
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: RPL13 PubMed Links

Gene Details

Gene: RPL13
Gene Name: ribosomal protein L13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000977.3	308	Silent Mutation	ATG,CTG	M78L	NP_000968.2
NM_001243130.1	308	Intron			NP_001230059.1
NM_001243131.1	308	Silent Mutation	ATG,CTG	M78L	NP_001230060.1
NM_033251.2	308	Silent Mutation	ATG,CTG	M78L	NP_150254.1

Gene: SNORD68
Gene Name: small nucleolar RNA, C/D box 68

There are no transcripts associated with this gene.

Gene: SPG7
Gene Name: SPG7, paraplegin matrix AAA peptidase subunit

There are no transcripts associated with this gene.

View Full Product Details