Product Details

SNP ID: rs181116711
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.15:74541552 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGCGTTTGAGATAAAGCGATGAGA[A/G]GGGTGAGGGGCCCTGGAGCTGAGTG
Phenotype: MIM: 612457
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: ARID3B PubMed Links
Additional Information: For this assay, SNP(s) [rs145891657] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001307939.1		Intron			NP_001294868.1
NM_006465.3		Intron			NP_006456.1