Product Details

SNP ID: rs181649442
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:20990053 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGACATTAGGAAGATGGTGCCCCGG[C/G]CTTGGAGTGGCTCCCCAGGCCCGGG
Phenotype: MIM: 616091 MIM: 612166
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: LOC101929718 PubMed Links

Gene Details

Gene: LOC101929718
Gene Name: uncharacterized LOC101929718

There are no transcripts associated with this gene.

Gene: METTL17
Gene Name: methyltransferase like 17

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001029991.1	248	Silent Mutation	GGC,GGG	G17G	NP_001025162.1
NM_022734.2	248	Silent Mutation	GGC,GGG	G17G	NP_073571.1
XM_006720236.2	248	Intron			XP_006720299.1
XM_017021601.1	248	Intron			XP_016877090.1

Gene: SLC39A2
Gene Name: solute carrier family 39 member 2

There are no transcripts associated with this gene.

View Full Product Details