Product Details

SNP ID: rs182493474
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:636168 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAAGGCCCGCGCGAAGTGCGCTGC[A/G]TGCTGGCCGGAGCCCGAGGCCACCT
Phenotype: MIM: 608021
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC100287175 PubMed Links

Gene Details

Gene: LOC100287175
Gene Name: uncharacterized LOC100287175

There are no transcripts associated with this gene.

Gene: MCRIP2
Gene Name: MAPK regulated corepressor interacting protein 2

There are no transcripts associated with this gene.

Gene: METTL26
Gene Name: methyltransferase like 26

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040160.2	197	Silent Mutation			NP_001035250.1
NM_001040161.2	197	Silent Mutation			NP_001035251.1
NM_001040162.2	197	Silent Mutation			NP_001035252.1
NM_001040165.2	197	Silent Mutation			NP_001035255.1
NM_001288710.1	197	Silent Mutation			NP_001275639.1
NM_032366.4	197	Silent Mutation			NP_115742.3
XM_011522713.2	197	Silent Mutation			XP_011521015.1
XM_011522714.2	197	Silent Mutation			XP_011521016.1

Gene: RAB40C
Gene Name: RAB40C, member RAS oncogene family

There are no transcripts associated with this gene.

Gene: WFIKKN1
Gene Name: WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1

There are no transcripts associated with this gene.

View Full Product Details